zen 2.3 sp1 (Carl Zeiss)
Carl Zeiss is a verified supplier 
Carl Zeiss manufactures this product 
90
Structured Review
Carl Zeiss
zen 2.3 sp1
Zen 2.3 Sp1, supplied by Carl Zeiss, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/zen+2%2E3/software+zen/pmc12268546-91-0-4
Average 90 stars, based on 1 article reviews
Zen 2.3 Sp1, supplied by Carl Zeiss, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/zen+2%2E3/software+zen/pmc12268546-91-0-4
Average 90 stars, based on 1 article reviews
zen 2.3 sp1 - by Bioz Stars,
2026-09
90/100 stars
Images
Related Articles
Software:Article Title: Small-molecule screen in C. elegans identifies benzenesulfonamides as inhibitors of microsporidia spores. Article Snippet: Article Title: RNF219 RING Finger Domain Mutants Drive Phase Separation to Encapsulate CCR4-NOT and Promote Cell Proliferation. Article Snippet: Raw images were processed using Article Title: Single-cell analysis of bidirectional reprogramming between early embryonic states identify mechanisms of differential lineage plasticities in mice Article Snippet: ZEN 2.3 , Article Title: Encoding the glucose identity by discrete hypothalamic neurons via the gut-brain axis. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Mouse: Fos 2A-iCreER (TRAP2): STOCK Fos tm2.1(icre/ERT2)Luo /J The Jackson Laboratory RRID: IMSR_JAX:030323 Mouse: C57BL/6J IMSR C57BL/6J Software and algorithms GraphPad Prism 9.0.2 GraphPad Software Inc., La Jolla, Article Title: Molecular logic for cellular specializations that initiate the auditory parallel processing pathways. Article Snippet: Typical FISH images were exported for the final layout with Article Title: Delayed progression of prion disease in mice by polyarginine-facilitated prevention of PrP Sc propagation in the spleen. Article Snippet: The degree of vacuolation in the brain was determined by counting the number of vacuoles within an arbitrary unit area of tissue sections using Article Title: A TFEB-TGFβ axis systemically regulates diapause, stem cell resilience and protects against a senescence-like state. Article Snippet: CGC Strain VC1003 Table 1 (continued) | Reagents Nature Aging Article https://doi.org/10.1038/s43587-025-00911-4 Reagent or resource Source Identifier C. elegans: vha-12(ok821) X. CGC Strain RB938 Killifish (Nothobranchius furzeri) AA lab Strain GRZ-AD Software and algorithms Flaski Bioinformatics Core Facility of the Max Planck Institute for Biology of Ageing NA Galaxy platform https://galaxyproject.org/ NA MiModD http://www.celegans.de/en/mimodd LAS X Leica Microsystems NA Zen 2.3 Zeiss Microscopy NA Flow Pilot Union Biometrica NA ImageJ National Institutes of Health NA Imaris Oxford instruments NA Photoshop and Illustrator Adobe NA Excel Microsoft NA Prism GraphPad NA R (survival) 81 NA Flexbar v2.5 82 NA HISAT v0.1.6-beta 83 NA StringTie v1.04 84 NA Cufflinks v2.2.1 85 NA Other SunyBiotech: CRISPR–Cas9 mutants https://www.sunybiotech.com/ qPCR primer daf-7, Fwd CTATTAGGGGCCAATTCCGCA qPCR daf-7, Fwd GAGGCGGGCTCTCATATCCA qPCR daf-7 3′ UTR, Fwd GAGGCGGGCTCTCATATCCA qPCR daf-7 3′ UTR, Rev TCGAAGGAGGTAGTGGAAGGA qPCR daf-1, Fwd ACAATAAAAGAAAGTCACGTGGCAA qPCR daf-1, Fwd ACAATAAAAGAAAGTCACGTGGCAA qPCR daf-1 3′ UTR, Fwd TCGAAGGAGGTAGTGGAAGGA qPCR daf-1 3′ UTR, Rev CTGAGGTACACGGTGAGGAG qPCR daf-8, Fwd TCAGGTGAGCTACTCAAATGGG qPCR daf-8, Fwd TCATACCAGTTTTCATTCCGAGTT qPCR daf-8 3′ UTR, Fwd TGCGTGTGATCAATTTTGTTGATAG qPCR daf-8 3′ UTR, Rev TCGAGCAGTTCTAAAGCCCTC qPCR daf-14, Fwd TCGATCACGTGCTATCGTTCC qPCR daf-14, Fwd ACGTGAGCTTCTGCTCCTAAC qPCR daf-14 3′ UTR, Fwd CGAATGCGTACCCGTTTGAT qPCR daf-14 3′ UTR, Rev AAGCATTCAAGAGACTGGGAA qPCR daf-3 P1, Fwd TGGAAAAGGGCGAGAGAGAG qPCR daf-3 P1, Fwd AGTCAAGATATGCGCAACGG qPCR daf-3 P2, Fwd ACCGAGGTCATGTGCACTCT qPCR daf-3 P2, Fwd ACCGAGGTCATGTGCACTCT qPCR daf-3 3′ UTR, Fwd GTTCATTGTGAGCTTTGAGCTGT qPCR daf-3 3′ UTR, Rev GGGCCACGGTGCAATATATGA qPCR lag-2, Fwd GCGCAATCGAAACAACAGGT qPCR lag-2, Rev CAAGACCCCGATGCGGTAAT qPCR lag-2 3′ UTR, Fwd GTGTGCTTCTTCCACGAGTA qPCR Table 1 (continued) | Reagents Nature Aging Article https://doi.org/10.1038/s43587-025-00911-4 of TFEB reduced survival of resistant cancer diapause-like cells by almost 50%, but did not affect survival of proliferating cancer cells (Fig. 5c). Article Title: A TFEB–TGFβ axis systemically regulates diapause, stem cell resilience and protects against a senescence-like state Article Snippet: CRISPR:Article Title: Small-molecule screen in C. elegans identifies benzenesulfonamides as inhibitors of microsporidia spores. Article Snippet: Article Title: RNF219 RING Finger Domain Mutants Drive Phase Separation to Encapsulate CCR4-NOT and Promote Cell Proliferation. Article Snippet: Raw images were processed using Article Title: Single-cell analysis of bidirectional reprogramming between early embryonic states identify mechanisms of differential lineage plasticities in mice Article Snippet: ZEN 2.3 , Article Title: Encoding the glucose identity by discrete hypothalamic neurons via the gut-brain axis. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Mouse: Fos 2A-iCreER (TRAP2): STOCK Fos tm2.1(icre/ERT2)Luo /J The Jackson Laboratory RRID: IMSR_JAX:030323 Mouse: C57BL/6J IMSR C57BL/6J Software and algorithms GraphPad Prism 9.0.2 GraphPad Software Inc., La Jolla, Article Title: Molecular logic for cellular specializations that initiate the auditory parallel processing pathways. Article Snippet: Typical FISH images were exported for the final layout with Article Title: Delayed progression of prion disease in mice by polyarginine-facilitated prevention of PrP Sc propagation in the spleen. Article Snippet: The degree of vacuolation in the brain was determined by counting the number of vacuoles within an arbitrary unit area of tissue sections using Article Title: A TFEB-TGFβ axis systemically regulates diapause, stem cell resilience and protects against a senescence-like state. Article Snippet: CGC Strain VC1003 Table 1 (continued) | Reagents Nature Aging Article https://doi.org/10.1038/s43587-025-00911-4 Reagent or resource Source Identifier C. elegans: vha-12(ok821) X. CGC Strain RB938 Killifish (Nothobranchius furzeri) AA lab Strain GRZ-AD Software and algorithms Flaski Bioinformatics Core Facility of the Max Planck Institute for Biology of Ageing NA Galaxy platform https://galaxyproject.org/ NA MiModD http://www.celegans.de/en/mimodd LAS X Leica Microsystems NA Zen 2.3 Zeiss Microscopy NA Flow Pilot Union Biometrica NA ImageJ National Institutes of Health NA Imaris Oxford instruments NA Photoshop and Illustrator Adobe NA Excel Microsoft NA Prism GraphPad NA R (survival) 81 NA Flexbar v2.5 82 NA HISAT v0.1.6-beta 83 NA StringTie v1.04 84 NA Cufflinks v2.2.1 85 NA Other SunyBiotech: CRISPR–Cas9 mutants https://www.sunybiotech.com/ qPCR primer daf-7, Fwd CTATTAGGGGCCAATTCCGCA qPCR daf-7, Fwd GAGGCGGGCTCTCATATCCA qPCR daf-7 3′ UTR, Fwd GAGGCGGGCTCTCATATCCA qPCR daf-7 3′ UTR, Rev TCGAAGGAGGTAGTGGAAGGA qPCR daf-1, Fwd ACAATAAAAGAAAGTCACGTGGCAA qPCR daf-1, Fwd ACAATAAAAGAAAGTCACGTGGCAA qPCR daf-1 3′ UTR, Fwd TCGAAGGAGGTAGTGGAAGGA qPCR daf-1 3′ UTR, Rev CTGAGGTACACGGTGAGGAG qPCR daf-8, Fwd TCAGGTGAGCTACTCAAATGGG qPCR daf-8, Fwd TCATACCAGTTTTCATTCCGAGTT qPCR daf-8 3′ UTR, Fwd TGCGTGTGATCAATTTTGTTGATAG qPCR daf-8 3′ UTR, Rev TCGAGCAGTTCTAAAGCCCTC qPCR daf-14, Fwd TCGATCACGTGCTATCGTTCC qPCR daf-14, Fwd ACGTGAGCTTCTGCTCCTAAC qPCR daf-14 3′ UTR, Fwd CGAATGCGTACCCGTTTGAT qPCR daf-14 3′ UTR, Rev AAGCATTCAAGAGACTGGGAA qPCR daf-3 P1, Fwd TGGAAAAGGGCGAGAGAGAG qPCR daf-3 P1, Fwd AGTCAAGATATGCGCAACGG qPCR daf-3 P2, Fwd ACCGAGGTCATGTGCACTCT qPCR daf-3 P2, Fwd ACCGAGGTCATGTGCACTCT qPCR daf-3 3′ UTR, Fwd GTTCATTGTGAGCTTTGAGCTGT qPCR daf-3 3′ UTR, Rev GGGCCACGGTGCAATATATGA qPCR lag-2, Fwd GCGCAATCGAAACAACAGGT qPCR lag-2, Rev CAAGACCCCGATGCGGTAAT qPCR lag-2 3′ UTR, Fwd GTGTGCTTCTTCCACGAGTA qPCR Table 1 (continued) | Reagents Nature Aging Article https://doi.org/10.1038/s43587-025-00911-4 of TFEB reduced survival of resistant cancer diapause-like cells by almost 50%, but did not affect survival of proliferating cancer cells (Fig. 5c). Article Title: A TFEB–TGFβ axis systemically regulates diapause, stem cell resilience and protects against a senescence-like state Article Snippet: Real-time Polymerase Chain Reaction:Article Title: Small-molecule screen in C. elegans identifies benzenesulfonamides as inhibitors of microsporidia spores. Article Snippet: Article Title: RNF219 RING Finger Domain Mutants Drive Phase Separation to Encapsulate CCR4-NOT and Promote Cell Proliferation. Article Snippet: Raw images were processed using Article Title: Single-cell analysis of bidirectional reprogramming between early embryonic states identify mechanisms of differential lineage plasticities in mice Article Snippet: ZEN 2.3 , Article Title: Encoding the glucose identity by discrete hypothalamic neurons via the gut-brain axis. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Mouse: Fos 2A-iCreER (TRAP2): STOCK Fos tm2.1(icre/ERT2)Luo /J The Jackson Laboratory RRID: IMSR_JAX:030323 Mouse: C57BL/6J IMSR C57BL/6J Software and algorithms GraphPad Prism 9.0.2 GraphPad Software Inc., La Jolla, Article Title: Molecular logic for cellular specializations that initiate the auditory parallel processing pathways. Article Snippet: Typical FISH images were exported for the final layout with Article Title: Delayed progression of prion disease in mice by polyarginine-facilitated prevention of PrP Sc propagation in the spleen. Article Snippet: The degree of vacuolation in the brain was determined by counting the number of vacuoles within an arbitrary unit area of tissue sections using Article Title: A TFEB-TGFβ axis systemically regulates diapause, stem cell resilience and protects against a senescence-like state. Article Snippet: CGC Strain VC1003 Table 1 (continued) | Reagents Nature Aging Article https://doi.org/10.1038/s43587-025-00911-4 Reagent or resource Source Identifier C. elegans: vha-12(ok821) X. CGC Strain RB938 Killifish (Nothobranchius furzeri) AA lab Strain GRZ-AD Software and algorithms Flaski Bioinformatics Core Facility of the Max Planck Institute for Biology of Ageing NA Galaxy platform https://galaxyproject.org/ NA MiModD http://www.celegans.de/en/mimodd LAS X Leica Microsystems NA Zen 2.3 Zeiss Microscopy NA Flow Pilot Union Biometrica NA ImageJ National Institutes of Health NA Imaris Oxford instruments NA Photoshop and Illustrator Adobe NA Excel Microsoft NA Prism GraphPad NA R (survival) 81 NA Flexbar v2.5 82 NA HISAT v0.1.6-beta 83 NA StringTie v1.04 84 NA Cufflinks v2.2.1 85 NA Other SunyBiotech: CRISPR–Cas9 mutants https://www.sunybiotech.com/ qPCR primer daf-7, Fwd CTATTAGGGGCCAATTCCGCA qPCR daf-7, Fwd GAGGCGGGCTCTCATATCCA qPCR daf-7 3′ UTR, Fwd GAGGCGGGCTCTCATATCCA qPCR daf-7 3′ UTR, Rev TCGAAGGAGGTAGTGGAAGGA qPCR daf-1, Fwd ACAATAAAAGAAAGTCACGTGGCAA qPCR daf-1, Fwd ACAATAAAAGAAAGTCACGTGGCAA qPCR daf-1 3′ UTR, Fwd TCGAAGGAGGTAGTGGAAGGA qPCR daf-1 3′ UTR, Rev CTGAGGTACACGGTGAGGAG qPCR daf-8, Fwd TCAGGTGAGCTACTCAAATGGG qPCR daf-8, Fwd TCATACCAGTTTTCATTCCGAGTT qPCR daf-8 3′ UTR, Fwd TGCGTGTGATCAATTTTGTTGATAG qPCR daf-8 3′ UTR, Rev TCGAGCAGTTCTAAAGCCCTC qPCR daf-14, Fwd TCGATCACGTGCTATCGTTCC qPCR daf-14, Fwd ACGTGAGCTTCTGCTCCTAAC qPCR daf-14 3′ UTR, Fwd CGAATGCGTACCCGTTTGAT qPCR daf-14 3′ UTR, Rev AAGCATTCAAGAGACTGGGAA qPCR daf-3 P1, Fwd TGGAAAAGGGCGAGAGAGAG qPCR daf-3 P1, Fwd AGTCAAGATATGCGCAACGG qPCR daf-3 P2, Fwd ACCGAGGTCATGTGCACTCT qPCR daf-3 P2, Fwd ACCGAGGTCATGTGCACTCT qPCR daf-3 3′ UTR, Fwd GTTCATTGTGAGCTTTGAGCTGT qPCR daf-3 3′ UTR, Rev GGGCCACGGTGCAATATATGA qPCR lag-2, Fwd GCGCAATCGAAACAACAGGT qPCR lag-2, Rev CAAGACCCCGATGCGGTAAT qPCR lag-2 3′ UTR, Fwd GTGTGCTTCTTCCACGAGTA qPCR Table 1 (continued) | Reagents Nature Aging Article https://doi.org/10.1038/s43587-025-00911-4 of TFEB reduced survival of resistant cancer diapause-like cells by almost 50%, but did not affect survival of proliferating cancer cells (Fig. 5c). Article Title: A TFEB–TGFβ axis systemically regulates diapause, stem cell resilience and protects against a senescence-like state Article Snippet: Microscopy:Article Title: Small-molecule screen in C. elegans identifies benzenesulfonamides as inhibitors of microsporidia spores. Article Snippet: Article Title: RNF219 RING Finger Domain Mutants Drive Phase Separation to Encapsulate CCR4-NOT and Promote Cell Proliferation. Article Snippet: Raw images were processed using Article Title: Single-cell analysis of bidirectional reprogramming between early embryonic states identify mechanisms of differential lineage plasticities in mice Article Snippet: ZEN 2.3 , Article Title: Encoding the glucose identity by discrete hypothalamic neurons via the gut-brain axis. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Mouse: Fos 2A-iCreER (TRAP2): STOCK Fos tm2.1(icre/ERT2)Luo /J The Jackson Laboratory RRID: IMSR_JAX:030323 Mouse: C57BL/6J IMSR C57BL/6J Software and algorithms GraphPad Prism 9.0.2 GraphPad Software Inc., La Jolla, Article Title: Molecular logic for cellular specializations that initiate the auditory parallel processing pathways. Article Snippet: Typical FISH images were exported for the final layout with Article Title: Delayed progression of prion disease in mice by polyarginine-facilitated prevention of PrP Sc propagation in the spleen. Article Snippet: The degree of vacuolation in the brain was determined by counting the number of vacuoles within an arbitrary unit area of tissue sections using Article Title: A TFEB-TGFβ axis systemically regulates diapause, stem cell resilience and protects against a senescence-like state. Article Snippet: CGC Strain VC1003 Table 1 (continued) | Reagents Nature Aging Article https://doi.org/10.1038/s43587-025-00911-4 Reagent or resource Source Identifier C. elegans: vha-12(ok821) X. CGC Strain RB938 Killifish (Nothobranchius furzeri) AA lab Strain GRZ-AD Software and algorithms Flaski Bioinformatics Core Facility of the Max Planck Institute for Biology of Ageing NA Galaxy platform https://galaxyproject.org/ NA MiModD http://www.celegans.de/en/mimodd LAS X Leica Microsystems NA Zen 2.3 Zeiss Microscopy NA Flow Pilot Union Biometrica NA ImageJ National Institutes of Health NA Imaris Oxford instruments NA Photoshop and Illustrator Adobe NA Excel Microsoft NA Prism GraphPad NA R (survival) 81 NA Flexbar v2.5 82 NA HISAT v0.1.6-beta 83 NA StringTie v1.04 84 NA Cufflinks v2.2.1 85 NA Other SunyBiotech: CRISPR–Cas9 mutants https://www.sunybiotech.com/ qPCR primer daf-7, Fwd CTATTAGGGGCCAATTCCGCA qPCR daf-7, Fwd GAGGCGGGCTCTCATATCCA qPCR daf-7 3′ UTR, Fwd GAGGCGGGCTCTCATATCCA qPCR daf-7 3′ UTR, Rev TCGAAGGAGGTAGTGGAAGGA qPCR daf-1, Fwd ACAATAAAAGAAAGTCACGTGGCAA qPCR daf-1, Fwd ACAATAAAAGAAAGTCACGTGGCAA qPCR daf-1 3′ UTR, Fwd TCGAAGGAGGTAGTGGAAGGA qPCR daf-1 3′ UTR, Rev CTGAGGTACACGGTGAGGAG qPCR daf-8, Fwd TCAGGTGAGCTACTCAAATGGG qPCR daf-8, Fwd TCATACCAGTTTTCATTCCGAGTT qPCR daf-8 3′ UTR, Fwd TGCGTGTGATCAATTTTGTTGATAG qPCR daf-8 3′ UTR, Rev TCGAGCAGTTCTAAAGCCCTC qPCR daf-14, Fwd TCGATCACGTGCTATCGTTCC qPCR daf-14, Fwd ACGTGAGCTTCTGCTCCTAAC qPCR daf-14 3′ UTR, Fwd CGAATGCGTACCCGTTTGAT qPCR daf-14 3′ UTR, Rev AAGCATTCAAGAGACTGGGAA qPCR daf-3 P1, Fwd TGGAAAAGGGCGAGAGAGAG qPCR daf-3 P1, Fwd AGTCAAGATATGCGCAACGG qPCR daf-3 P2, Fwd ACCGAGGTCATGTGCACTCT qPCR daf-3 P2, Fwd ACCGAGGTCATGTGCACTCT qPCR daf-3 3′ UTR, Fwd GTTCATTGTGAGCTTTGAGCTGT qPCR daf-3 3′ UTR, Rev GGGCCACGGTGCAATATATGA qPCR lag-2, Fwd GCGCAATCGAAACAACAGGT qPCR lag-2, Rev CAAGACCCCGATGCGGTAAT qPCR lag-2 3′ UTR, Fwd GTGTGCTTCTTCCACGAGTA qPCR Table 1 (continued) | Reagents Nature Aging Article https://doi.org/10.1038/s43587-025-00911-4 of TFEB reduced survival of resistant cancer diapause-like cells by almost 50%, but did not affect survival of proliferating cancer cells (Fig. 5c). Article Title: A TFEB–TGFβ axis systemically regulates diapause, stem cell resilience and protects against a senescence-like state Article Snippet: Imaging:Article Title: Small-molecule screen in C. elegans identifies benzenesulfonamides as inhibitors of microsporidia spores. Article Snippet: Article Title: RNF219 RING Finger Domain Mutants Drive Phase Separation to Encapsulate CCR4-NOT and Promote Cell Proliferation. Article Snippet: Raw images were processed using Article Title: Single-cell analysis of bidirectional reprogramming between early embryonic states identify mechanisms of differential lineage plasticities in mice Article Snippet: ZEN 2.3 , Article Title: Encoding the glucose identity by discrete hypothalamic neurons via the gut-brain axis. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Mouse: Fos 2A-iCreER (TRAP2): STOCK Fos tm2.1(icre/ERT2)Luo /J The Jackson Laboratory RRID: IMSR_JAX:030323 Mouse: C57BL/6J IMSR C57BL/6J Software and algorithms GraphPad Prism 9.0.2 GraphPad Software Inc., La Jolla, Article Title: Molecular logic for cellular specializations that initiate the auditory parallel processing pathways. Article Snippet: Typical FISH images were exported for the final layout with Article Title: Delayed progression of prion disease in mice by polyarginine-facilitated prevention of PrP Sc propagation in the spleen. Article Snippet: The degree of vacuolation in the brain was determined by counting the number of vacuoles within an arbitrary unit area of tissue sections using Article Title: A TFEB-TGFβ axis systemically regulates diapause, stem cell resilience and protects against a senescence-like state. Article Snippet: CGC Strain VC1003 Table 1 (continued) | Reagents Nature Aging Article https://doi.org/10.1038/s43587-025-00911-4 Reagent or resource Source Identifier C. elegans: vha-12(ok821) X. CGC Strain RB938 Killifish (Nothobranchius furzeri) AA lab Strain GRZ-AD Software and algorithms Flaski Bioinformatics Core Facility of the Max Planck Institute for Biology of Ageing NA Galaxy platform https://galaxyproject.org/ NA MiModD http://www.celegans.de/en/mimodd LAS X Leica Microsystems NA Zen 2.3 Zeiss Microscopy NA Flow Pilot Union Biometrica NA ImageJ National Institutes of Health NA Imaris Oxford instruments NA Photoshop and Illustrator Adobe NA Excel Microsoft NA Prism GraphPad NA R (survival) 81 NA Flexbar v2.5 82 NA HISAT v0.1.6-beta 83 NA StringTie v1.04 84 NA Cufflinks v2.2.1 85 NA Other SunyBiotech: CRISPR–Cas9 mutants https://www.sunybiotech.com/ qPCR primer daf-7, Fwd CTATTAGGGGCCAATTCCGCA qPCR daf-7, Fwd GAGGCGGGCTCTCATATCCA qPCR daf-7 3′ UTR, Fwd GAGGCGGGCTCTCATATCCA qPCR daf-7 3′ UTR, Rev TCGAAGGAGGTAGTGGAAGGA qPCR daf-1, Fwd ACAATAAAAGAAAGTCACGTGGCAA qPCR daf-1, Fwd ACAATAAAAGAAAGTCACGTGGCAA qPCR daf-1 3′ UTR, Fwd TCGAAGGAGGTAGTGGAAGGA qPCR daf-1 3′ UTR, Rev CTGAGGTACACGGTGAGGAG qPCR daf-8, Fwd TCAGGTGAGCTACTCAAATGGG qPCR daf-8, Fwd TCATACCAGTTTTCATTCCGAGTT qPCR daf-8 3′ UTR, Fwd TGCGTGTGATCAATTTTGTTGATAG qPCR daf-8 3′ UTR, Rev TCGAGCAGTTCTAAAGCCCTC qPCR daf-14, Fwd TCGATCACGTGCTATCGTTCC qPCR daf-14, Fwd ACGTGAGCTTCTGCTCCTAAC qPCR daf-14 3′ UTR, Fwd CGAATGCGTACCCGTTTGAT qPCR daf-14 3′ UTR, Rev AAGCATTCAAGAGACTGGGAA qPCR daf-3 P1, Fwd TGGAAAAGGGCGAGAGAGAG qPCR daf-3 P1, Fwd AGTCAAGATATGCGCAACGG qPCR daf-3 P2, Fwd ACCGAGGTCATGTGCACTCT qPCR daf-3 P2, Fwd ACCGAGGTCATGTGCACTCT qPCR daf-3 3′ UTR, Fwd GTTCATTGTGAGCTTTGAGCTGT qPCR daf-3 3′ UTR, Rev GGGCCACGGTGCAATATATGA qPCR lag-2, Fwd GCGCAATCGAAACAACAGGT qPCR lag-2, Rev CAAGACCCCGATGCGGTAAT qPCR lag-2 3′ UTR, Fwd GTGTGCTTCTTCCACGAGTA qPCR Table 1 (continued) | Reagents Nature Aging Article https://doi.org/10.1038/s43587-025-00911-4 of TFEB reduced survival of resistant cancer diapause-like cells by almost 50%, but did not affect survival of proliferating cancer cells (Fig. 5c). Article Title: A TFEB–TGFβ axis systemically regulates diapause, stem cell resilience and protects against a senescence-like state Article Snippet: Staining:Article Title: Small-molecule screen in C. elegans identifies benzenesulfonamides as inhibitors of microsporidia spores. Article Snippet: Article Title: RNF219 RING Finger Domain Mutants Drive Phase Separation to Encapsulate CCR4-NOT and Promote Cell Proliferation. Article Snippet: Raw images were processed using Article Title: Single-cell analysis of bidirectional reprogramming between early embryonic states identify mechanisms of differential lineage plasticities in mice Article Snippet: ZEN 2.3 , Article Title: Encoding the glucose identity by discrete hypothalamic neurons via the gut-brain axis. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Mouse: Fos 2A-iCreER (TRAP2): STOCK Fos tm2.1(icre/ERT2)Luo /J The Jackson Laboratory RRID: IMSR_JAX:030323 Mouse: C57BL/6J IMSR C57BL/6J Software and algorithms GraphPad Prism 9.0.2 GraphPad Software Inc., La Jolla, Article Title: Molecular logic for cellular specializations that initiate the auditory parallel processing pathways. Article Snippet: Typical FISH images were exported for the final layout with Article Title: Delayed progression of prion disease in mice by polyarginine-facilitated prevention of PrP Sc propagation in the spleen. Article Snippet: The degree of vacuolation in the brain was determined by counting the number of vacuoles within an arbitrary unit area of tissue sections using Article Title: A TFEB-TGFβ axis systemically regulates diapause, stem cell resilience and protects against a senescence-like state. Article Snippet: CGC Strain VC1003 Table 1 (continued) | Reagents Nature Aging Article https://doi.org/10.1038/s43587-025-00911-4 Reagent or resource Source Identifier C. elegans: vha-12(ok821) X. CGC Strain RB938 Killifish (Nothobranchius furzeri) AA lab Strain GRZ-AD Software and algorithms Flaski Bioinformatics Core Facility of the Max Planck Institute for Biology of Ageing NA Galaxy platform https://galaxyproject.org/ NA MiModD http://www.celegans.de/en/mimodd LAS X Leica Microsystems NA Zen 2.3 Zeiss Microscopy NA Flow Pilot Union Biometrica NA ImageJ National Institutes of Health NA Imaris Oxford instruments NA Photoshop and Illustrator Adobe NA Excel Microsoft NA Prism GraphPad NA R (survival) 81 NA Flexbar v2.5 82 NA HISAT v0.1.6-beta 83 NA StringTie v1.04 84 NA Cufflinks v2.2.1 85 NA Other SunyBiotech: CRISPR–Cas9 mutants https://www.sunybiotech.com/ qPCR primer daf-7, Fwd CTATTAGGGGCCAATTCCGCA qPCR daf-7, Fwd GAGGCGGGCTCTCATATCCA qPCR daf-7 3′ UTR, Fwd GAGGCGGGCTCTCATATCCA qPCR daf-7 3′ UTR, Rev TCGAAGGAGGTAGTGGAAGGA qPCR daf-1, Fwd ACAATAAAAGAAAGTCACGTGGCAA qPCR daf-1, Fwd ACAATAAAAGAAAGTCACGTGGCAA qPCR daf-1 3′ UTR, Fwd TCGAAGGAGGTAGTGGAAGGA qPCR daf-1 3′ UTR, Rev CTGAGGTACACGGTGAGGAG qPCR daf-8, Fwd TCAGGTGAGCTACTCAAATGGG qPCR daf-8, Fwd TCATACCAGTTTTCATTCCGAGTT qPCR daf-8 3′ UTR, Fwd TGCGTGTGATCAATTTTGTTGATAG qPCR daf-8 3′ UTR, Rev TCGAGCAGTTCTAAAGCCCTC qPCR daf-14, Fwd TCGATCACGTGCTATCGTTCC qPCR daf-14, Fwd ACGTGAGCTTCTGCTCCTAAC qPCR daf-14 3′ UTR, Fwd CGAATGCGTACCCGTTTGAT qPCR daf-14 3′ UTR, Rev AAGCATTCAAGAGACTGGGAA qPCR daf-3 P1, Fwd TGGAAAAGGGCGAGAGAGAG qPCR daf-3 P1, Fwd AGTCAAGATATGCGCAACGG qPCR daf-3 P2, Fwd ACCGAGGTCATGTGCACTCT qPCR daf-3 P2, Fwd ACCGAGGTCATGTGCACTCT qPCR daf-3 3′ UTR, Fwd GTTCATTGTGAGCTTTGAGCTGT qPCR daf-3 3′ UTR, Rev GGGCCACGGTGCAATATATGA qPCR lag-2, Fwd GCGCAATCGAAACAACAGGT qPCR lag-2, Rev CAAGACCCCGATGCGGTAAT qPCR lag-2 3′ UTR, Fwd GTGTGCTTCTTCCACGAGTA qPCR Table 1 (continued) | Reagents Nature Aging Article https://doi.org/10.1038/s43587-025-00911-4 of TFEB reduced survival of resistant cancer diapause-like cells by almost 50%, but did not affect survival of proliferating cancer cells (Fig. 5c). Article Title: A TFEB–TGFβ axis systemically regulates diapause, stem cell resilience and protects against a senescence-like state Article Snippet: Fluorescence:Article Title: Small-molecule screen in C. elegans identifies benzenesulfonamides as inhibitors of microsporidia spores. Article Snippet: Article Title: RNF219 RING Finger Domain Mutants Drive Phase Separation to Encapsulate CCR4-NOT and Promote Cell Proliferation. Article Snippet: Raw images were processed using Article Title: Single-cell analysis of bidirectional reprogramming between early embryonic states identify mechanisms of differential lineage plasticities in mice Article Snippet: ZEN 2.3 , Article Title: Encoding the glucose identity by discrete hypothalamic neurons via the gut-brain axis. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Mouse: Fos 2A-iCreER (TRAP2): STOCK Fos tm2.1(icre/ERT2)Luo /J The Jackson Laboratory RRID: IMSR_JAX:030323 Mouse: C57BL/6J IMSR C57BL/6J Software and algorithms GraphPad Prism 9.0.2 GraphPad Software Inc., La Jolla, Article Title: Molecular logic for cellular specializations that initiate the auditory parallel processing pathways. Article Snippet: Typical FISH images were exported for the final layout with Article Title: Delayed progression of prion disease in mice by polyarginine-facilitated prevention of PrP Sc propagation in the spleen. Article Snippet: The degree of vacuolation in the brain was determined by counting the number of vacuoles within an arbitrary unit area of tissue sections using Article Title: A TFEB-TGFβ axis systemically regulates diapause, stem cell resilience and protects against a senescence-like state. Article Snippet: CGC Strain VC1003 Table 1 (continued) | Reagents Nature Aging Article https://doi.org/10.1038/s43587-025-00911-4 Reagent or resource Source Identifier C. elegans: vha-12(ok821) X. CGC Strain RB938 Killifish (Nothobranchius furzeri) AA lab Strain GRZ-AD Software and algorithms Flaski Bioinformatics Core Facility of the Max Planck Institute for Biology of Ageing NA Galaxy platform https://galaxyproject.org/ NA MiModD http://www.celegans.de/en/mimodd LAS X Leica Microsystems NA Zen 2.3 Zeiss Microscopy NA Flow Pilot Union Biometrica NA ImageJ National Institutes of Health NA Imaris Oxford instruments NA Photoshop and Illustrator Adobe NA Excel Microsoft NA Prism GraphPad NA R (survival) 81 NA Flexbar v2.5 82 NA HISAT v0.1.6-beta 83 NA StringTie v1.04 84 NA Cufflinks v2.2.1 85 NA Other SunyBiotech: CRISPR–Cas9 mutants https://www.sunybiotech.com/ qPCR primer daf-7, Fwd CTATTAGGGGCCAATTCCGCA qPCR daf-7, Fwd GAGGCGGGCTCTCATATCCA qPCR daf-7 3′ UTR, Fwd GAGGCGGGCTCTCATATCCA qPCR daf-7 3′ UTR, Rev TCGAAGGAGGTAGTGGAAGGA qPCR daf-1, Fwd ACAATAAAAGAAAGTCACGTGGCAA qPCR daf-1, Fwd ACAATAAAAGAAAGTCACGTGGCAA qPCR daf-1 3′ UTR, Fwd TCGAAGGAGGTAGTGGAAGGA qPCR daf-1 3′ UTR, Rev CTGAGGTACACGGTGAGGAG qPCR daf-8, Fwd TCAGGTGAGCTACTCAAATGGG qPCR daf-8, Fwd TCATACCAGTTTTCATTCCGAGTT qPCR daf-8 3′ UTR, Fwd TGCGTGTGATCAATTTTGTTGATAG qPCR daf-8 3′ UTR, Rev TCGAGCAGTTCTAAAGCCCTC qPCR daf-14, Fwd TCGATCACGTGCTATCGTTCC qPCR daf-14, Fwd ACGTGAGCTTCTGCTCCTAAC qPCR daf-14 3′ UTR, Fwd CGAATGCGTACCCGTTTGAT qPCR daf-14 3′ UTR, Rev AAGCATTCAAGAGACTGGGAA qPCR daf-3 P1, Fwd TGGAAAAGGGCGAGAGAGAG qPCR daf-3 P1, Fwd AGTCAAGATATGCGCAACGG qPCR daf-3 P2, Fwd ACCGAGGTCATGTGCACTCT qPCR daf-3 P2, Fwd ACCGAGGTCATGTGCACTCT qPCR daf-3 3′ UTR, Fwd GTTCATTGTGAGCTTTGAGCTGT qPCR daf-3 3′ UTR, Rev GGGCCACGGTGCAATATATGA qPCR lag-2, Fwd GCGCAATCGAAACAACAGGT qPCR lag-2, Rev CAAGACCCCGATGCGGTAAT qPCR lag-2 3′ UTR, Fwd GTGTGCTTCTTCCACGAGTA qPCR Table 1 (continued) | Reagents Nature Aging Article https://doi.org/10.1038/s43587-025-00911-4 of TFEB reduced survival of resistant cancer diapause-like cells by almost 50%, but did not affect survival of proliferating cancer cells (Fig. 5c). Article Title: A TFEB–TGFβ axis systemically regulates diapause, stem cell resilience and protects against a senescence-like state Article Snippet: |